This option is used to check if a repeated sequence could
be involved in the mutational event. In this hypothesis, a repeated
sequence is created by the insertion process to complete a partially
duplicated sequence.
For example the CGA sequence is inserted in the ctttctacgattaattaaggca and result in ctttctacgattaaCGAttaaggca. the repated sequence created by the insertion process is cgattaa (ctttctaCGATTAACGATTAAggca).
|
Total number of insertions: 7 (9 records) Small insertions with known sequences: 7 (9 records) Insertions involving repeated sequences: 6 (85.71 %) |
AA Position | Mutation | Repeated sequence | Number of records | Insertion Repeated sequences |
---|---|---|---|---|
427 | c.1280dup | TTTTTT | agtgcaggagattgatgatgactttttTcccaagttctggggaagaagctgaagctgctt | |
1171 | c.3513dup | TT | caggctcaaacagaagctttttgggagaaTtaaacaaatggaaaataatttttataagca | |
1198 | c.3591_3592dup | GAGAGA | gtgtggcagaagaagagaccctggagaGAaacatctgagaccaaagcaaaagcctaagaa | |
417 | c.1248dup | AAAA | gcccaagggcgggaaacggcagaagaaaAgtgccagtgcaggagattgatgatgactttt | |
325 | c.972dup | AAAAAAA | agaaagccagagttctgtccaaaaaaAgaggagcgtttgaaaaagcacatcaagaaactc | |
659 | c.1971_1974dup | TGTCTGTC | aaattcgaaatccaaatgctgctgtcTGTCacccttgcttgcaaacagtttcgcacccct |